Take the 2-minute tour ×
Ask Patents is a question and answer site for people interested in improving and participating in the patent system. It's 100% free, no registration required.

Is a specific PCR (polymerase chain reaction) protocol including primers to detect the presence of a specific organism in a probe patentable in the US or/and elsewhere?

e.g. A blood test for tuberculosis using TCCAGCCATTGACCATCGTC, CGATGTGGTAGCAGGATTT, Taq polymerase with std. Buffer 20 cycles each of 30 sec annealing at 60°C and so on...

Examples from Google Patents: ep2559761a1, wo2009093856a2, ep1380654a1

I have heard that it is no longer possible in the US to patent DNA that occurs in nature. Is that true? Does this include Primer sequences? How is the situation elsewhere?

share|improve this question
    
A quick search on Google Patents brings up the granted US patent - Use of whole blood in PCR reactions US 8470563 google.com/patents/US8470563 You can also look for EPO examples there. –  George White Jan 21 at 22:01
    
My comment above is not an answer, just a pointer to something that might be helpful. –  George White Jan 21 at 22:16
    
Thanks. US 8470563 describes a new Polymerase (different). I will have linked some example patents soon. –  YAK Jan 21 at 22:44
add comment

Your Answer

 
discard

By posting your answer, you agree to the privacy policy and terms of service.

Browse other questions tagged or ask your own question.