0

Is a specific PCR (polymerase chain reaction) protocol including primers to detect the presence of a specific organism in a probe patentable in the US or/and elsewhere?

e.g. A blood test for tuberculosis using TCCAGCCATTGACCATCGTC, CGATGTGGTAGCAGGATTT, Taq polymerase with std. Buffer 20 cycles each of 30 sec annealing at 60°C and so on...

Examples from Google Patents: ep2559761a1, wo2009093856a2, ep1380654a1

I have heard that it is no longer possible in the US to patent DNA that occurs in nature. Is that true? Does this include Primer sequences? How is the situation elsewhere?

Improve this question
3
  • A quick search on Google Patents brings up the granted US patent - Use of whole blood in PCR reactions US 8470563 google.com/patents/US8470563 You can also look for EPO examples there.
    – George White ♦
    Jan 21, 2014 at 22:01
  • My comment above is not an answer, just a pointer to something that might be helpful.
    – George White ♦
    Jan 21, 2014 at 22:16
  • Thanks. US 8470563 describes a new Polymerase (different). I will have linked some example patents soon.
    – jan-glx
    Jan 21, 2014 at 22:44

1 Answer 1

Reset to default
1

Depends on how the claim is worded. In the US, isolated and purified DNA is not patentable per se, though it used to be. The rationale being that its a "natural product" even though isolated DNA isn't, nevertheless, the Supreme Court said the differences weren't great enough to make it patentable. cDNA by contrast is patentable.
However, specific uses for isolated and purified DNA are likely to still be patentable.

The Fed. Cir. recently went to town on this question and said a pair of primers isn't patentable either, although pairs of primers don't exit in nature, and the current Guidance doesn't even address the issue.

This area of law has been rapidly changing and can be expected to change again. Meanwhile, there are many ways to avoid these results and get meaningful claim coverage.

http://www.supremecourt.gov/opinions/12pdf/12-398_1b7d.pdf

http://www.cafc.uscourts.gov/images/stories/opinions-orders/14-1361.Opinion.12-15-2014.1.PDF

http://www.uspto.gov/patent/laws-and-regulations/examination-policy/examination-guidance-and-training-materials

Improve this answer
1
  • So... anybody could use the primers, but only I could use them to test for tuberculosis?
    – jan-glx
    Mar 16, 2015 at 9:19

You must log in to answer this question.

Not the answer you're looking for? Browse other questions tagged .